Biology / Sequences
DNA Sequence Tools (Reverse Complement, GC Content, Translation)
Paste a DNA or RNA sequence, plain or FASTA, and get its length, base counts, GC content, reverse complement, complement, translation in all six reading frames, and the longest open reading frame.
DNA Sequence Tools (Reverse Complement, GC Content, Translation): The reverse complement reads the other strand 5′ to 3′: reverse the sequence and swap A↔T and C↔G, with ambiguity codes complemented too. Translation reads codons with the standard genetic code, in frames starting at the first, second, and third base of each strand; * marks a stop. The longest open reading frame runs from an ATG to the next stop. Results match Biopython. Runs 100% locally in your browser with zero server file uploads.
- Category
- School & study tools
- Runs
- In your browser
- Cost
- Free · no sign-up
- Availability
- Ready to use
Runs entirely in your browser
Reverse complement
CTATCGGGCACCCTTTCAGCGGCCCATTACAATGGCCAT
Complement
TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC
Translation in six frames
+1 MAIVMGR*KGAR* +2 WPL*WAAERVPD +3 GHCNGPLKGCPI −1 LSGTLSAAHYNGH −2 YRAPFQRPITMA −3 IGHPFSGPLQWP
Longest ORF protein
MAIVMGR
Paste a sequence in plain text or FASTA format; U is read as T, and anything that is not a base letter is removed. Translation uses the standard genetic code, with * for stop codons and X for codons containing ambiguous bases. Frames +1 to +3 read the strand as given from the first, second, and third base; −1 to −3 read the reverse complement. The longest ORF runs from an ATG to the next stop, or to the end of the sequence.
Worked example
ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG is 39 bp with 56.4% GC. Frame +1 reads MAIVMGR*KGAR*, so the open reading frame from the first ATG codes for the 7 amino acids MAIVMGR before the TGA stop.
To design primers on the sequence, check their melting temperature with the primer Tm calculator.
GC content
GC pairs have three hydrogen bonds and A–T pairs two, so GC-rich DNA melts at higher temperatures. Genomes range from below 20% GC in some parasites to above 70% in some bacteria; human DNA averages about 41%.
For inheritance at the level of whole genes, use the Punnett square calculator.
How to use it
- Paste the sequence; FASTA headers, numbers, and spaces are removed.
- Read the length, base counts, and GC content.
- Copy the reverse complement or a translation.
Privacy & limitations
Your sequences stay in your browser; nothing is uploaded.
Related tools
Frequently asked questions
Why reverse complement?
DNA strands run in opposite directions, so the sequence of the other strand, read the usual way, is the reverse complement; primers for the reverse strand are written this way.
Is RNA supported?
Yes: U is read as T, so results are given in DNA letters.
Which genetic code is used?
The standard code (NCBI table 1); mitochondrial and some microbial genes use slightly different codes.
Free tool · runs in your browser · no account required