Biology / PCR
Primer Tm Calculator (Melting Temperature)
Work out a PCR primer's melting temperature by the nearest-neighbour method with salt correction, the Wallace rule, and the GC formula, with its GC content and a warning for self-complementary stretches that can form hairpins or dimers.
Primer Tm Calculator (Melting Temperature): The nearest-neighbour Tm adds the enthalpy and entropy of each overlapping base pair from SantaLucia's 1998 unified table, with terminal and salt corrections, and solves Tm = ΔH ÷ (ΔS + R ln(C/4)) − 273.15. With C/4 as the strand concentration, as Primer3 uses, it agrees with Biopython's Tm_NN to within 0.01 °C: the M13 reverse primer AGCGGATAACAATTTCACACAGGA at 250 nM and 50 mM Na⁺ is 56.7 °C. The Wallace rule, 2 °C per A or T and 4 °C per G or C, gives 68 °C for it and suits only short oligos. Runs 100% locally in your browser with zero server file uploads.
- Category
- School & study tools
- Runs
- In your browser
- Cost
- Free · no sign-up
- Availability
- Ready to use
Runs entirely in your browser
The nearest-neighbour method adds up the stability of each overlapping pair of bases, using SantaLucia's 1998 unified values with his salt correction, and gives the temperature at which half the primer is bound; with C/4 for the strand concentration, as Primer3 uses, it agrees with Biopython's Tm_NN to 0.01 °C. The Wallace rule and the GC formula are quicker approximations. Good PCR primers are usually 18–25 bases with 40–60% GC, and a primer pair should be within about 5 °C of each other; a typical annealing temperature is 3–5 °C below the lower Tm. Mg²⁺ and dNTPs, which this does not model, also raise Tm.
Primer design guidelines
Aim for 18–25 bases, 40–60% GC, a G or C at the 3′ end, no runs of four or more of one base, and Tm values within 5 °C of each other for the pair.
To check the template and the reverse primer's sequence, use the DNA sequence tools.
Concentrations
Raising the primer concentration or the salt raises Tm: the same primer gains roughly 1–2 °C from 50 to 100 mM Na⁺. Mg²⁺, which PCR buffers contain at 1.5–2.5 mM, stabilises duplexes further but is not modelled here.
To make up primer stocks and working dilutions, use the dilution calculator.
How to use it
- Paste the primer, written 5′ to 3′.
- Adjust the primer and sodium concentrations if your buffer differs.
- Read the Tm by each method, the GC content, and any self-complementary stretch.
Privacy & limitations
Everything is calculated in your browser.
Related tools
Frequently asked questions
Which Tm should I use?
The nearest-neighbour value: it accounts for the sequence order and the buffer. Many polymerase suppliers' calculators add their own buffer corrections, so expect differences of a few degrees.
What annealing temperature should I set?
Usually 3–5 °C below the lower Tm of the pair, then optimise with a gradient PCR.
Why does the self-complementary warning matter?
A primer that pairs with itself or its partner can form dimers or hairpins that compete with the target and give extra bands.
Free tool · runs in your browser · no account required